ODN 2006 Biotin Biotin labeled CpG oligonucleotide - Human TLR9 ligand CpG ODNs are synthetic oligonucleotides that contain unmethylated CpG dinucleotides in particular sequence contexts (CpG motifs). These CpG motifs are present at a 20-fold greater frequency in bacterial DNA compared to mammalian DNA. They have been shown to induce a coordinated set of immune responses based on the activation of immune cells primarily involved in the recognition of these molecules. ODN 2006 Biotin is a B-class CpG ODN specific for human TLR9. ODN 2006 Biotin can be used to evaluate CpG ODN cellular uptake and localization using a biotin detection system and light microscopy. Synonyms: ODN 7909, PF_3512676 Specificity: Human TLR9 agonist Working concentration: 10 ng -10 μg/ml ODN 2006 sequence 5’- tgctgcttttgtgcttttgtgctt -3’ (24 mer) Note: Bases are phosphorothioate (nuclease resistant).
