ODN 2006 control (ODN 2137) Negative control for ODN 2006 ODN 2006 Control (ODN 2137) contains GpC dinucleotides instead of CpGs and can be used as a negative control for ODN 2006 (type B specific for human TLR9). Synonym: ODN 2137 Working concentration: 5 µM (10 μg/ml) Solubility: 5 mg/ml in water ODN 2006 Control sequence 5’- tgctgcttttgtgcttttgtgctt -3’ (24 mer) Note: Bases are phosphorothioate (nuclease resistant). Quality control - The absence of bacterial contamination (endotoxins, peptidoglycans) is controlled using HEK-Blue™ TLR2 and HEK-Blue™ TLR4 cells.
