|
siRNA Cloning Vector (pGB)
Product Overview
Product Highlights:
• (GeneBlocker™ siRNA Cloning Vector, pGB)
• Application- The pGB siRNA vectors can be transfected into mammalian cells using Lipofectamine (Invitrogen). For transient transfection, cells can be analyzed in 24-96 hours following transfections, by Western blot analysis or other detection means. For stable transfections, cells can be selected in G418 selection medium to obtain stable cell lines with the specific gene blocked.The pGB cloning vector is designed for cloning your own siRNA insert.
• Features and Positions: Human U6 Promoter: 1-256 Multiple cloning Site: 259-285 3’ Primer: 398-426 (GAAGCATTTATCAGGGTTATTGTCTCATG) SV40 Promoter: 470-808 Neomycin/Kanamycin Resistance ORF: 843-1634 5’ Primer: 2789-2813 (CGTCGATTTTTGTGATGCTCGTCAG) pUC Origin of Replication: 2222-3003
Description: pGB expression vectors contain the human U6 RNA polymerase III promoter, which directs constitutive, high-level expression of short RNA transcripts in many cells. Each vector also contains the neomycin/kanamycin-resistance gene to provide kanamycin resistance in bacteria and the G418 resistance in mammalian cells. The pGB vector is used to clone your own insert. The vector contains two unique restriction sites, BamH I and Xba I for directional cloning. The pGB Negative Control vector contains a insert that does not have significant homology to mammalian genes expressed in human, mouse, and rat, and it can be used as a negative control for pGB-Caspase siRNA vectors. The pGB Caspase siRNA vectors contain the siRNA inserts designed to suppress the expression of each caspase individually
Storage Temp.: -20°C
Shipping: gel pack
Usage: For Research Use Only! Not For Use in Humans. |